View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18569_low_13 (Length: 292)
Name: NF18569_low_13
Description: NF18569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18569_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 3880445 - 3880688
Alignment:
| Q |
18 |
ttaacattctttagcctgcttgttgttcgctgcatgtagagcctgacttcagttcgcttcatcagcacctcgataatcagtctttctctaggcggttgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3880445 |
ttaacattctttagcctgcttgttgttcgctgcatgtagagcctgacttcagttcgcttcatcagcacctcgataatcagtctttctctaggcggttgtc |
3880544 |
T |
 |
| Q |
118 |
gagcaatcactactcttgagctaacctgccctaatcttgagaaggtcattttggacagttgtgatcatttggaatatgcatcattttgccctgtaagtga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3880545 |
gagcaatcactactcttgagctaacctgccctaatcttgagaaggtcattttggacagctgtgatcatttggaatatgcatcattttgccctgtaagtga |
3880644 |
T |
 |
| Q |
218 |
cattgatttattatacaatttatacttgatttttgtgagatgag |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3880645 |
cattgatttattatacaatttatacttgatttttgtgagatgag |
3880688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 41 - 230
Target Start/End: Original strand, 3866593 - 3866782
Alignment:
| Q |
41 |
tgttcgctgcatgtagagcctgacttcagttcgcttcatcagcacctcgataatcagtctttctctaggcggttgtcgagcaatcactactcttgagcta |
140 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||| ||||||||||||||| || ||||||| || || || ||||| |||||| | ||||||||||||||| |
|
|
| T |
3866593 |
tgtttgctgcatgtagagcttgacttcagttcggttcatcagcacctcgttagtcagtctctcccttggtggttgccgagcagttactactcttgagcta |
3866692 |
T |
 |
| Q |
141 |
acctgccctaatcttgagaaggtcattttggacagttgtgatcatttggaatatgcatcattttgccctgtaagtgacattgatttatta |
230 |
Q |
| |
|
|| |||||| |||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||| | |||| ||||| |
|
|
| T |
3866693 |
acatgcccttatcttgagaaggtcatattggatggttgtgatcatttggaaaatgcatcattttgccctgtaagtgatactgatatatta |
3866782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University