View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18569_low_17 (Length: 248)
Name: NF18569_low_17
Description: NF18569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18569_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 27372141 - 27371904
Alignment:
| Q |
1 |
attttattttgaaatttgaagaaatcaaca-------acatcaaattaggaatagtagtaaaagtttatggtcattcaactcaaaagtactctaacacc- |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
27372141 |
attttattttgaaatttgaagaaatcaacattcaacaacaccaaattaggaatagtagtaaaagtttatggtcagtcaactcaaaag---tctaacacct |
27372045 |
T |
 |
| Q |
93 |
--acacctttacaaatttacatagtagacccaactaccctttaatttcacgtccatacttcaaataaaattttgtaatggctttgtttccctttgtttgt |
190 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
27372044 |
catcacctttacaaatttacctagtacacccacctaccctttaatttcacgtccatacttcaaacaaaattttgtaatggctctgtatccctttgtttgt |
27371945 |
T |
 |
| Q |
191 |
tgtcttattgtcataattgtatcccaagccaaagccttatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27371944 |
tgtcttattgtcataattgtatcccaagccaaagccatatt |
27371904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University