View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18569_low_19 (Length: 233)

Name: NF18569_low_19
Description: NF18569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18569_low_19
NF18569_low_19
[»] chr7 (1 HSPs)
chr7 (73-178)||(25520658-25520763)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 73 - 178
Target Start/End: Original strand, 25520658 - 25520763
Alignment:
73 ggatagttgatagttttgattctactgaatgtaagagacggagagattttttggaaaagaggatgtgagagcttagacttagaaagagatagcttgagag 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25520658 ggatagttgatagttttgattctactgaatgtaagagacggagagattttttggaaaagaggatgtgagagcttagacttagaaagagatagcttgagag 25520757  T
173 gtaacc 178  Q
    ||||||    
25520758 gtaacc 25520763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University