View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18569_low_19 (Length: 233)
Name: NF18569_low_19
Description: NF18569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18569_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 73 - 178
Target Start/End: Original strand, 25520658 - 25520763
Alignment:
| Q |
73 |
ggatagttgatagttttgattctactgaatgtaagagacggagagattttttggaaaagaggatgtgagagcttagacttagaaagagatagcttgagag |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25520658 |
ggatagttgatagttttgattctactgaatgtaagagacggagagattttttggaaaagaggatgtgagagcttagacttagaaagagatagcttgagag |
25520757 |
T |
|
| Q |
173 |
gtaacc |
178 |
Q |
| |
|
|||||| |
|
|
| T |
25520758 |
gtaacc |
25520763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University