View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_16 (Length: 227)

Name: NF1856_high_16
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_high_16
NF1856_high_16
[»] chr3 (1 HSPs)
chr3 (1-227)||(31784854-31785080)


Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 31784854 - 31785080
Alignment:
1 atgatgaaaactttgaacatgtctcaactgagaaccaaaacctttggttgcaagatttgaataatcaggttgatgaaacagttgtttttaaaccatatga 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
31784854 atgatggaaactttgaacatgtctcaactgagaaccaaaacctttggttgcaagatttgtataatcaggttgatgaaacagttgtttttaaaccatatga 31784953  T
101 ttttgattcccttgatgatagagtgttgaaattggtaagaaataacttcaacaaaattcttggatccgagtgtgccttacaaatccaaacagaagtcatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31784954 ttttgattcccttgatgatagagtgttgaaattggtaagaaataacttcaacaaaattcttggatccgagtgtgccttacaaatccaaacagaagtcatg 31785053  T
201 gatcaattgcttgcagctgcatacgtc 227  Q
    |||||||||||||||||||||||||||    
31785054 gatcaattgcttgcagctgcatacgtc 31785080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University