View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_19 (Length: 220)

Name: NF1856_high_19
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_high_19
NF1856_high_19
[»] chr3 (1 HSPs)
chr3 (1-218)||(55103568-55103785)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 55103568 - 55103785
Alignment:
1 aatttgaggcagatggaggagctcttttctgggggatagattactacaacaatgaattattgcattctgataaggaacgagttggttctgtgacaacaga 100  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
55103568 aatttgaggcagatggagtagctcttttctgggggatagattactacaacaatgaattattgcattctgataaggaccgagttggttctgtgacaacaga 55103667  T
101 gatactattggaaaaagatgagaattccttcacattgcaaaacggatggacatttccaagaagaatatatttcaacggtgaaaactgtgacatgccttta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55103668 gatactattggaaaaagatgagaattccttcacattgcaaaacggatggacatttccaagaagaatatatttcaacggtgaaaactgtgacatgccttta 55103767  T
201 cctgacacattccctatg 218  Q
    ||||||||||||||||||    
55103768 cctgacacattccctatg 55103785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University