View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_low_14 (Length: 271)

Name: NF1856_low_14
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_low_14
NF1856_low_14
[»] chr6 (1 HSPs)
chr6 (10-253)||(419512-419755)


Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 253
Target Start/End: Complemental strand, 419755 - 419512
Alignment:
10 gcagagaaaaatatagagtattgattttgacagatggggtgatgccaggattacttcagttaaccgtcgatggaacgtggagagccaaatcgacggctag 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
419755 gcagagaaaaatatagagtattgattttgacagatggggtgatgccaggattacttcagttaaccgtcgatggaacgtggagagccaaatcgacggctag 419656  T
110 ggaattgttgttgcttctgagagactgctctagttatagctcgagaagtacacaaattaatcacaagcttatagaacagataatggaagaaattgataca 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
419655 ggaattgttgttgcttctgagagactgctctagttatagctcgagaagtacacaaattaatcacaagcttatagaacagataatggaagaaattgataca 419556  T
210 gaaggagagaaattgacagatactactttgagattggtagagga 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
419555 gaaggagagaaattgacagatactactttgagattggtagagga 419512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University