View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1856_low_19 (Length: 220)
Name: NF1856_low_19
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1856_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 55103568 - 55103785
Alignment:
| Q |
1 |
aatttgaggcagatggaggagctcttttctgggggatagattactacaacaatgaattattgcattctgataaggaacgagttggttctgtgacaacaga |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55103568 |
aatttgaggcagatggagtagctcttttctgggggatagattactacaacaatgaattattgcattctgataaggaccgagttggttctgtgacaacaga |
55103667 |
T |
|
| Q |
101 |
gatactattggaaaaagatgagaattccttcacattgcaaaacggatggacatttccaagaagaatatatttcaacggtgaaaactgtgacatgccttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55103668 |
gatactattggaaaaagatgagaattccttcacattgcaaaacggatggacatttccaagaagaatatatttcaacggtgaaaactgtgacatgccttta |
55103767 |
T |
|
| Q |
201 |
cctgacacattccctatg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
55103768 |
cctgacacattccctatg |
55103785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University