View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1857-Insertion-10 (Length: 163)
Name: NF1857-Insertion-10
Description: NF1857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1857-Insertion-10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 6e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 6e-48
Query Start/End: Original strand, 8 - 112
Target Start/End: Original strand, 8587740 - 8587844
Alignment:
| Q |
8 |
aagagtgcattattttaatcaatacttctgaattctataattgttggtcctatcttttttatgctgctttctggttttcattcttgaataatcatatgtt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8587740 |
aagagtgcattattttaatcaatacttctgaattctataattgttggtcatatcttttttatgctgctttctggttttcattcttgaataatcataagtt |
8587839 |
T |
|
| Q |
108 |
caatt |
112 |
Q |
| |
|
||||| |
|
|
| T |
8587840 |
caatt |
8587844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.0000000009
Query Start/End: Original strand, 62 - 138
Target Start/End: Original strand, 5363220 - 5363296
Alignment:
| Q |
62 |
ttttttatgctgctttctggttttcattcttgaataatcatatgttcaattgtatatcctcaggatgaatatcagtt |
138 |
Q |
| |
|
||||| |||||||||| || |||| |||||||||||||||||||| |||||||||||| ||||||||| |||| |
|
|
| T |
5363220 |
tttttcatgctgctttgtgattttggttcttgaataatcatatgtttggttgtatatcctctcgatgaatattagtt |
5363296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University