View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1857-Insertion-11 (Length: 123)
Name: NF1857-Insertion-11
Description: NF1857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1857-Insertion-11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 123
Target Start/End: Complemental strand, 848920 - 848805
Alignment:
| Q |
8 |
ttttcaatatctttgtatgtgctcctgatagtgagaaatcagcagttagtcacagcatcacatggcttcatcctatatctgccaaaaaagttcacattca |
107 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
848920 |
ttttcaatatatttgtatgtgctcctgatagtgagaaatcagcagttagtcacagcatcacatggcttcatcctatatctgccaaacaagttcatattca |
848821 |
T |
|
| Q |
108 |
tggaaccattgcttcc |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
848820 |
tggaaccattgcttcc |
848805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 4e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 37 - 113
Target Start/End: Original strand, 47053644 - 47053720
Alignment:
| Q |
37 |
agtgagaaatcagcagttagtcacagcatcacatggcttcatcctatatctgccaaaaaagttcacattcatggaac |
113 |
Q |
| |
|
|||||||||||||| || |||||||| || ||||||||||| |||||| ||||||| |||||||||||| ||||||| |
|
|
| T |
47053644 |
agtgagaaatcagctgtgagtcacagtattacatggcttcaccctatagctgccaagaaagttcacattgatggaac |
47053720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 38 - 115
Target Start/End: Original strand, 47063525 - 47063603
Alignment:
| Q |
38 |
gtgagaaatcagcagttagtcacagcatcacat-ggcttcatcctatatctgccaaaaaagttcacattcatggaacca |
115 |
Q |
| |
|
|||||||||||| ||||||||| | || |||| ||||||| |||||||||||||| |||| |||| || ||||||||| |
|
|
| T |
47063525 |
gtgagaaatcagatgttagtcacggtattacattggcttcaccctatatctgccaagaaagctcaccttgatggaacca |
47063603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University