View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18570_high_2 (Length: 292)
Name: NF18570_high_2
Description: NF18570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18570_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 31642919 - 31643045
Alignment:
| Q |
1 |
cttgggaaactagaactcatgcacgacacaaagataagcaattgagatcaatgaatccaattgccatgaagttatagaagaaagcaacttagcatatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31642919 |
cttgggaaactagaactcatgcacgacacaaagataagcaattgagatcaatgaatccaattgccatgaagttatagaagaaagcaacttagcatatcag |
31643018 |
T |
|
| Q |
101 |
atttgttgcagatttatcagatttcac |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31643019 |
atttgttgcagatttatcagatttcac |
31643045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 200 - 284
Target Start/End: Original strand, 31643118 - 31643202
Alignment:
| Q |
200 |
tcatcacaaattttctaactatattgattatattctttttactttttcagtagacagaaatagatgtccatcattttcttcgaga |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31643118 |
tcatcacaaattttctaactatattgattatattctttttactttttcagtagacagaaatagatgtccatcattttcttagaga |
31643202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University