View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18570_high_3 (Length: 225)
Name: NF18570_high_3
Description: NF18570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18570_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 207
Target Start/End: Complemental strand, 5397322 - 5397129
Alignment:
| Q |
14 |
cataggcccaaataatggtcttccaactattttcttcttcttcacatacgcccaaactcgctttggcccttactcttcacacctcccattttgctactac |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5397322 |
cataggcctaaataatggtcttccaactattttcatcttcttcacatacgcccaaactcgctttggcccttactcttcacacctcccattttgctactac |
5397223 |
T |
 |
| Q |
114 |
atcgagcaaatgtttagatttcgtaagactgtaaggcctcctccgcatgcattcaaaatgcaatgttcgattgttacagaccccatcgtctata |
207 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5397222 |
atcgagcaaatgtttagatttcgtaagtctgtaacgcctcctccgcatgcattcaaaatgcaatgttcgattgttacagaccccatcgtctata |
5397129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 67 - 123
Target Start/End: Original strand, 5407468 - 5407524
Alignment:
| Q |
67 |
aaactcgctttggcccttactcttcacacctcccattttgctactacatcgagcaaa |
123 |
Q |
| |
|
||||| ||||||| || ||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
5407468 |
aaacttgctttggtccatactcttcacaccgcccattttgttactacatcgagcaaa |
5407524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University