View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18571_high_8 (Length: 208)
Name: NF18571_high_8
Description: NF18571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18571_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 24 - 189
Target Start/End: Original strand, 43281305 - 43281470
Alignment:
| Q |
24 |
tatctctcacctgttaaatgcaacccttgtcctgctaaagtcgaacgcgtttcatattggaatgaaacaaggcaattcatcttcttgtttatgtggaatt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43281305 |
tatctctcacctgttaaatgcaacccttgtcctgctaaagtcgaacgtgtttcatattggaatgaaacaagtcaattcatcttcttgtttatgtggaatt |
43281404 |
T |
 |
| Q |
124 |
gtttttatttgcaacttcttattggaaataatggatattggttggttaccaccaattgtgacagta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43281405 |
gtttttatttgcaacttcttattggaaataatggatattggttggttgccaccaattgtgacagta |
43281470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 74 - 171
Target Start/End: Complemental strand, 2555294 - 2555198
Alignment:
| Q |
74 |
ttcatattggaatgaaacaaggcaattcatcttcttgtttatgtggaattgtttttatttgcaacttcttattggaaataatggatattggttggtta |
171 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| | || ||||||||||| ||||||||||| || ||| | |||||||||| ||||||||||||| |
|
|
| T |
2555294 |
ttcatattggaatgaaacaaggcaatttatctttctattactgtggaattgtctttatttgcaa-tttttaattgaaataatggttattggttggtta |
2555198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University