View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18571_low_6 (Length: 328)
Name: NF18571_low_6
Description: NF18571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18571_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 13 - 170
Target Start/End: Original strand, 15942829 - 15942987
Alignment:
| Q |
13 |
acattgagctcttttaacataagatccataacagtgatggtgtcataaagacgcaacaccatattatatttataagtctaacaaagagtgaacttatgtg |
112 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15942829 |
acattgagctcttttaacacaagatccataacagtgatggtgtcataaagacgcaacaccatattatatttataagtctaacaaagagtgagattatgtg |
15942928 |
T |
 |
| Q |
113 |
cattct-aaaatctcaacatgaacaatgcaggggattattatgattttgtaaaaaccat |
170 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15942929 |
cattctaaaaatctcaacatgaacaatgcaggggattattatgattttgtaaaaaccat |
15942987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 165 - 308
Target Start/End: Original strand, 15953137 - 15953280
Alignment:
| Q |
165 |
aaccatgcatgaaaattttcatgtccattaggttcttgggtaacgccaccaaaatcaccctgatcagacttcagaaacacattatccatgttaacaacaa |
264 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15953137 |
aaccatgcacgaaaattttcatgtccattaggttcttgggtaacgccaccaaaatcaccctgatcagacttcagaaacacactatccatgttaacaacaa |
15953236 |
T |
 |
| Q |
265 |
cattgtcctatttgttcgggaccaagaagccatgtgcgaaggag |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15953237 |
cattgtcctatttgttcgggaccaagaagccatgtgtgaaggag |
15953280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University