View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18571_low_8 (Length: 247)
Name: NF18571_low_8
Description: NF18571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18571_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 38568988 - 38569160
Alignment:
| Q |
1 |
gagaaatcattcattaacgaatataatttcgtagcatggttttatgttaccttggtcacttggtcaacaatgtcctcggtgttagtttggttactaccga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568988 |
gagaaatcattcattaacgaatataatttcgtagcatggttttatgttaccttggtcacttggtcaacaatgtcctcggtgttagtttggttactaccga |
38569087 |
T |
 |
| Q |
101 |
aactatgaatcatttgaccgaggagcactgtcatgataggtaaacccaaaccatttccaatagcaccaatagt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569088 |
aactatgaatcatttgaccgaggagcactgtcatgataggtaaacccaaaccatttccaatagcaccaatagt |
38569160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 41 - 173
Target Start/End: Original strand, 38527615 - 38527747
Alignment:
| Q |
41 |
tttatgttaccttggtcacttggtcaacaatgtcctcggtgttagtttggttactaccgaaactatgaatcatttgaccgaggagcactgtcatgatagg |
140 |
Q |
| |
|
|||||| |||||||| |||||| || |||| || ||||||| ||||||||||||| ||||||| |||||||||||||| | | |||||| | ||| |
|
|
| T |
38527615 |
tttatgataccttggacacttgttctacaacatcggtggtgttactttggttactaccaaaactatcaatcatttgaccgaacaataatgtcataagagg |
38527714 |
T |
 |
| Q |
141 |
taaacccaaaccatttccaatagcaccaatagt |
173 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| |
|
|
| T |
38527715 |
taaacccaaaccgtttccaatagcaccgatagt |
38527747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University