View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18572_high_12 (Length: 209)
Name: NF18572_high_12
Description: NF18572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18572_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 44040900 - 44041078
Alignment:
| Q |
15 |
atgtcacaactcacaatgtatcaattttgttctgaattcaagttatttttgttgtgtttctcannnnnnnctgtatggccttgcagtgagagcagcaaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
44040900 |
atgtcacaactcacaatgtatcaattttgttccgaattcaagttatttttgttgtgtttctcatttttttctgtttggccttgcagtgagagcagcaaag |
44040999 |
T |
 |
| Q |
115 |
ttcattgttcgggaaaattggattatcgcggcaactgatgacaaatatattcgcgtctacaattatgagaaaatggaaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041000 |
ttcattgttcgggaaaattggattatcgcggcaactgatgacaaatatattcgcgtctacaattatgagaaaatggaaa |
44041078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University