View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18573_high_17 (Length: 264)
Name: NF18573_high_17
Description: NF18573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18573_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 33318138 - 33317907
Alignment:
| Q |
16 |
atggctaacttcaccacaagtgtatgaatcaagtaactttaagagtaactcaaagcaaagnnnnnnnnnnnnncatgaattatgtcacccaaatatcaaa |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33318138 |
atggctaacttcaccgcaagtgtatgaatcaagtaactttaagagtaactcaaagcaaagtttttttctttttcatgaattatgtcacccaaatatcaaa |
33318039 |
T |
|
| Q |
116 |
cacaaatttttctgaacaatttatc---ggtggaacttattaaccatttgagctcatatttgca-gcatctcttattcattnnnnnnnnnnnnnnngcat |
211 |
Q |
| |
|
|||||||| || ||||||||||||| ||||||||| |||||| ||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
33318038 |
cacaaattcttttgaacaatttatcattggtggaactcattaactatttgagctcatatttgcacgcatctcttattcatt-----aaaaaaaaaagcat |
33317944 |
T |
|
| Q |
212 |
tacatttacctacccatgttctttgacgaacactctg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33317943 |
tacatttacctacccatgttctttgacgaacactctg |
33317907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University