View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18573_low_12 (Length: 280)
Name: NF18573_low_12
Description: NF18573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18573_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 277
Target Start/End: Original strand, 1811067 - 1811325
Alignment:
| Q |
19 |
aggacgtgtaagggtgcagcaccgagggattcttctcaccgtcaaagggatagtaatcaggtcaggagcaattaagatgcacgaaggagagaggaagtac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1811067 |
aggacgtgtaagggtgcagcaccgagggattcttctcactgtcaaagggatagtaatcaggtcaggagcaattaagatgcacgaaggagagaggaagtac |
1811166 |
T |
 |
| Q |
119 |
atgtgccagaaatgcaatggcaggtacatgcgttctcctcttcccctttttctcccactttataatttgcaaggaaaggatcatctattagtcactcttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1811167 |
atgtgccagaaatgcaatggcaggtacatgcgttctcctcttcccctttttctcccactttataatttgcaaggaaaggatcatctattagtcactcttg |
1811266 |
T |
 |
| Q |
219 |
gtcattttatcttttgcaaatattagctgtactattaaatgcttaataattttgatatt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1811267 |
gtcattttatcttttgcaaatattagctgtactattaaatgcttaataattttgttatt |
1811325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University