View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18574_high_15 (Length: 250)
Name: NF18574_high_15
Description: NF18574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18574_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 2787695 - 2787458
Alignment:
| Q |
1 |
ccttccttcgatctataggaacggccaatgcactcacgtacacaccatcatgatccatttccttttaattatatgtgcactctcttgtttcttttttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787695 |
ccttccttcgatctataggaacggccaatgtactcacgtacacaccatcatgatccatttccttttaattatatgtgcactctcttgtttcttttttcac |
2787596 |
T |
|
| Q |
101 |
tttacagatagttttcacggcgctgatggtaacgtttactacggttttgttaccccgaaagggttatccgtttttaaaccaggacttgctgttttggttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787595 |
tttacagatagttttcacggcgctgatggtaatgtttactatggttttgttaccccgaaagggttatccgtttttaaaccaggacttgctgttttggttc |
2787496 |
T |
|
| Q |
201 |
ctaacgacgacaaatacaaggtagggtttcaagatttt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787495 |
ctaacgacgacaaatacaaggtagggtttcaagatttt |
2787458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 19577899 - 19578135
Alignment:
| Q |
1 |
ccttccttcgatctataggaacggccaatgcactcacgtacacaccatcatgatccatttccttttaattatatgtgcactctcttgtttcttttttcac |
100 |
Q |
| |
|
||||||||| ||||| | || || ||||||||||| || || |||||||||||||||||||| ||||| || |||||||||||||||||||| |||||| |
|
|
| T |
19577899 |
ccttccttcaatctaccgaaatggtcaatgcactcatgttcataccatcatgatccatttcctcttaatcatgtgtgcactctcttgtttcttctttcac |
19577998 |
T |
|
| Q |
101 |
tttacagatagttttcacggcgctgatggtaacgtttactacggttttgttaccccgaaagggttatccgtttttaaaccaggacttgctgttttggttc |
200 |
Q |
| |
|
||||| || |||||||||||||| ||||||||||||||||| ||||||| ||| | ||| ||||| || ||||||||||| ||||| |||||||||||| |
|
|
| T |
19577999 |
tttaccgacagttttcacggcgcggatggtaacgtttactatggttttgctactcggaacgggttgtctgtttttaaaccgggactcactgttttggttc |
19578098 |
T |
|
| Q |
201 |
ctaacgacgacaaatacaaggtagggtttcaagattt |
237 |
Q |
| |
|
|||| || ||||| ||||| || |||||||||||||| |
|
|
| T |
19578099 |
ctaatgatgacaagtacaaagttgggtttcaagattt |
19578135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University