View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18574_low_11 (Length: 312)
Name: NF18574_low_11
Description: NF18574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18574_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 6 - 152
Target Start/End: Complemental strand, 43008924 - 43008778
Alignment:
| Q |
6 |
agagatgaagatgagctaggaaatgataattaattaaggaatgcattattgaattgtgagtgctatccataggaaggagcacaagctatgcaagctagaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008924 |
agagatgaagatgagctaggaaatgataattaattaaggaatgcattattgaattgtgagtgctatccataggaaggagcacaagctatgcaagctagaa |
43008825 |
T |
 |
| Q |
106 |
aaagaatggcagaagaaagaccatcctcttccacattggaactactc |
152 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008824 |
aaagaattgcagaagaaagaccatcctcttccacattggaactactc |
43008778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 239 - 312
Target Start/End: Complemental strand, 43008691 - 43008618
Alignment:
| Q |
239 |
cttcttcattgcttcttctactttagacaccataatgttcttttgaatgatttgaagaaaaatgaaacaaaatt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43008691 |
cttcttcattgcttcttctactttagacaccataatgttcttttgaatgatttgaagaacaatgaaacaaaatt |
43008618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University