View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18574_low_12 (Length: 303)
Name: NF18574_low_12
Description: NF18574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18574_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 284
Target Start/End: Original strand, 33562127 - 33562400
Alignment:
| Q |
11 |
gagtgagatgaacgttgacaaagacaataggcaacactcacatagaagacgggtgaaaacggttccctattcttttcggcaacacttttccgagttttgt |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
33562127 |
gagtgagataaacgttgacaaagacaataggcaacactcacatagaagacgggtgaaaacgattccctattcttttcagcaacacttttctgagttttgt |
33562226 |
T |
 |
| Q |
111 |
caacttctaaatttttggttgtgaggctaaaagttgtagtgcaatttactattttttataataagtttagtaaattgccaatttgaaaaacaacaatttc |
210 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
33562227 |
caacttctaaatttttgttggtgaggctaaaagttgtagtgcaatttactattttttataataagtttagtaaattgtcaatttgaaaaacaataatttc |
33562326 |
T |
 |
| Q |
211 |
tttgaagaccataacttacaactctattacttgaactatttggtacatttgttaaatttgtcatcatagtacca |
284 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33562327 |
tttgaagaccatatcttacaactctattacttgaactatttggtacacttgttaaatttgtcatcatagtacca |
33562400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 198 - 276
Target Start/End: Complemental strand, 16721215 - 16721137
Alignment:
| Q |
198 |
aaacaacaatttctttgaagaccataacttacaactctattacttgaactatttggtacatttgttaaatttgtcatca |
276 |
Q |
| |
|
|||||||||| ||| | ||||| ||||||||| ||| ||||||||| | | |||||| || |||| ||||||||||||| |
|
|
| T |
16721215 |
aaacaacaatctctataaagacgataacttactactttattacttggaatgtttggtgcacttgtcaaatttgtcatca |
16721137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University