View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18574_low_14 (Length: 290)
Name: NF18574_low_14
Description: NF18574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18574_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 4496870 - 4497143
Alignment:
| Q |
1 |
ttctaaaaggagattataacaaaataaattgttctcaggtgttgacaaagaaatatgtttccctcaaccaacagagatatttttgttagagtatttgaaa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4496870 |
ttctaacaggagattataacaaaataaattgttctcaggtgttgacaaagaaatatgtttccctcaaccaacagagatatttttgttagagtatttgaaa |
4496969 |
T |
 |
| Q |
101 |
tatctttgatactatgtcaggaagttttagttgatttt-taggatcagtttttaatccttgattatctcctagttggttttctggtggtttgttcttcgg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4496970 |
tatctttgatactatgtcaggaagttttagttgattttttaggatcagtttttaatccttgattatctcctagttggttttctggtggtttgttcttcgg |
4497069 |
T |
 |
| Q |
200 |
cacaaagattaattgttctagcgttctttgttggtttctccaatatattttttaggtttgtttatgttaggtat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4497070 |
cacaaagattaattgttctagcgttctttgttggtttctccaatatattttttaggtttgtttatgttaggtat |
4497143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University