View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18574_low_15 (Length: 261)
Name: NF18574_low_15
Description: NF18574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18574_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 9474214 - 9474413
Alignment:
| Q |
10 |
gggataatattgctggcatagttccacaagggcaaactagacattcacttaaagaatgttccataaaagtgaaagcttagcttcaaaaggtttcaaagaa |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9474214 |
gggataatattgctggcatagctccacaagggcaaactagacattcacttaaagaatgttccataaaagtgaaagcttagcttcaaaaggtttcaaagaa |
9474313 |
T |
 |
| Q |
110 |
agattaaccaagaggaaacaaagttgagggaaatttggatgcttttcaaattaatgttgctcactgttgttaaatatcggaatttgaggaaatcgctatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
9474314 |
agattaaccaagaggaaacaaagttgagggaaatttgaatgcttttcaaattaatgttgctcaccgttgttaaatatcggaatttgaggaaatcgttatt |
9474413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University