View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18574_low_17 (Length: 246)
Name: NF18574_low_17
Description: NF18574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18574_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 43008612 - 43008389
Alignment:
| Q |
1 |
tttaagatgctagctatagatggtattttgtgcttggatatccatacaactacaagtacttccccttttatagagttttgtaagtagagatctaaatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008612 |
tttaagatgctagctatagatggtatgttgtgcttggatatccatacaa------ggacttccccttttatagagttttgtaagtagagatctaaatgca |
43008519 |
T |
 |
| Q |
101 |
ccttgttttctgccagttttcacttagctattagatactccaattggcaattggtacaaggttaggnnnnnnnaccaatattgtttgttaatttaataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43008518 |
ccttgttttctgccagttttcacttagctattagatactccaattggcaattggtacaaggttaggcccccccaccaatattgtttgttaatttaataat |
43008419 |
T |
 |
| Q |
201 |
aaataagagataagtttgcactatcttttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43008418 |
aaataagagataagtttgcactatcttttt |
43008389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University