View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18575_high_16 (Length: 475)
Name: NF18575_high_16
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18575_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 431; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 431; E-Value: 0
Query Start/End: Original strand, 7 - 457
Target Start/End: Complemental strand, 456931 - 456481
Alignment:
| Q |
7 |
tccaagaatatctctcaatccaacggttattttctcagcatcactggtttcaatagcgtcaacgccgtcggtggactcttcctatgtcgtggcgacgtcg |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456931 |
tccaataatatctctcaatccaacggttattttctcggcatcactggtttcaatagcgtcaacgccgtcggtggactcttcctatgtcgtggcgacgtcg |
456832 |
T |
 |
| Q |
107 |
ccaccaccgtatgtaaccagtgtctcacaactgcaatcaaagagataagacagcattgtccaaaccaaaccgaagcactcatctggtacgacgagtgctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456831 |
ccaccaccgtatgtaaccagtgtctcacaactgcaatcaaagagataagacagcattgtccaaaccaaaccgaagcactcatctggtacgacgagtgctt |
456732 |
T |
 |
| Q |
207 |
cgttcgttacacaaataggtactttgccgtcgacaagattgaccctagagtcaaccttaacgacggaaatattgtctctagcgttgacttgggacgtttc |
306 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456731 |
ggttcattacacaaataggtactttgccgtcgacaagattgaccctagagtcaaccttaacgacggaaatattgtctctagcgttgacttgggacgtttc |
456632 |
T |
 |
| Q |
307 |
aaccaatctctgcatgggttgttgaatgatttggcaacagaagcctccgggagttctgagtcgaagaagtttgctgccggtgaagtagtggtgacggagt |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
456631 |
aaccaatctctgcatgggttgttgaatgatttggcaacagaagcctccgggagttctgagtcgaagaagtttgccgccggtgaagtagtggtgacggagt |
456532 |
T |
 |
| Q |
407 |
ccatgacggtgtatggattgatgcagtgcacgaatgacttaacgaatagtg |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456531 |
ccatgacggtgtatggattgatgcagtgcacgaatgacttaacgaatagtg |
456481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University