View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18575_high_52 (Length: 240)
Name: NF18575_high_52
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18575_high_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 33858625 - 33858439
Alignment:
| Q |
18 |
agttgggtttggttcggctccttgaagctgttgctgcaggtgnnnnnnnnggctggtccggttttaaggggggttttt-gtatagcttctgttttggtga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33858625 |
agttgggtttggttcggctccttgaagctgttgctgcaggtgtttttt--ggctggtccggttttaaggggggttttttgtatagcttctgttttggtga |
33858528 |
T |
|
| Q |
117 |
ttggctttgtccgcgcctcccttgtaactgtgcnnnnnnnnnnnctgcttgttctttgcttctgctgtgttttgtaacagaaggcaggact |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33858527 |
ttggctttgtccgcgcctcccttgtaactgtg--tgctttttttctacttgttctttgcttctgctgtgttttgtaacagaaggcaggact |
33858439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University