View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18575_high_62 (Length: 215)
Name: NF18575_high_62
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18575_high_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 78 - 198
Target Start/End: Complemental strand, 27783298 - 27783173
Alignment:
| Q |
78 |
tttcaacaaggataatt-agaattttaacnnnnnnnttgtgggtaattttgtcactatagtgtattattctgttatccttcccgtagttaat----taat |
172 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||| |||||||| |||| |
|
|
| T |
27783298 |
tttcaacaaggataatttagaattttaacaaaaaaattgtgggtaattttgtcactatagtgtattattctgtcatccctcccctagttaattaattaat |
27783199 |
T |
|
| Q |
173 |
ggtaaatgaattgatgaggtggcatc |
198 |
Q |
| |
|
|||||||| ||||||||||||||||| |
|
|
| T |
27783198 |
ggtaaatggattgatgaggtggcatc |
27783173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 78 - 144
Target Start/End: Original strand, 27776617 - 27776684
Alignment:
| Q |
78 |
tttcaacaaggataatt-agaattttaacnnnnnnnttgtgggtaattttgtcactatagtgtattat |
144 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27776617 |
tttcaacaaggataatttaaaattttaactaaaaaattgtgggtaattttgtcactatagtgtattat |
27776684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University