View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18575_high_63 (Length: 203)
Name: NF18575_high_63
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18575_high_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 16 - 185
Target Start/End: Complemental strand, 6722195 - 6722026
Alignment:
| Q |
16 |
acagacaaggaatgatagtgtacgatagattgaggcaattagtgaattgtgacatttgcgtcgccgatcgtgaatgtattacaaatgtaacttatgacca |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||| || ||||| ||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
6722195 |
acagacaaggaatgatattgtacgatagattgaggcaattagtgaactgtaacgtttgcctcgccaatcgtgaatgcattacaaatggaacttatgacca |
6722096 |
T |
 |
| Q |
116 |
catctttcaaggcgaatcctccttctttagcacttacgtgaacgtcctatcttacttgattcttcgacat |
185 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6722095 |
catctctcaagacgaatcctccttctttagcacttacgtgaacgtcctatcttacttgattcttcgacat |
6722026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University