View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18575_low_36 (Length: 292)
Name: NF18575_low_36
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18575_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 36717709 - 36717439
Alignment:
| Q |
1 |
caaggtgtgaacttcttatccttccatgtaggcttatctgtttcatttaaatttggcttcattgccttatccaacttttgaaataaaataaaacatatag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36717709 |
caaggtgtgaacttcttatccttccatgtaggcttatctgtttcatttaaatttggcttcattgccttatccaacttttgaaataaaataaaacatatat |
36717610 |
T |
 |
| Q |
101 |
gatgctta---aactgtaccataattcccttaaattctaggatgctttattccacaactaattaaaattagtccaacgtacttcacaatttttatgtagg |
197 |
Q |
| |
|
| ||| | || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36717609 |
aa-gctaatgcaattgtaccat---tcccttaaattctaggatgctttattccacaactaattaaaattagtccaacgtacttcacaatttttatgtagg |
36717514 |
T |
 |
| Q |
198 |
attttatattttccgtaaatcttacccttccaataagtttttatcacaaatagcatgcaaatgttacttaccact |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36717513 |
attttatattttccgtaaatcttacccttccaataagtttttatcacaaatagcatgaaaatgttacttaccact |
36717439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University