View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18575_low_46 (Length: 251)
Name: NF18575_low_46
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18575_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 23034040 - 23034275
Alignment:
| Q |
1 |
aaccatactcagcagcaacataaagtgctgtttctccaccttgattctgctttgcaaatatttcgcgcagtttaccctcttcagcaccatcaactgtatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23034040 |
aaccatactcagcagcaacataaagtgctgtttctccaccttgattctgctttgcaaatatttcgcgcagtttaccctcttcagcaccatcaactgtatc |
23034139 |
T |
|
| Q |
101 |
cttcaaagaagccatgttccctgctcttgctgccgaatgtaacggcgtatcgtcgcgcttccccgtcaattgttttgtcattttcttcctttgagccctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23034140 |
cttcaaagaagccatgttccctgctcttgctgctgaatgtaacggcgtatcgtcgcgcttccccgtcaattgtttcgtcattttcttcctttgagccctt |
23034239 |
T |
|
| Q |
201 |
actggtgcagcctgaggctgcacagtttcagcttct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
23034240 |
actggtgcagcctgaggctgcacagtttcagcttct |
23034275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 41067100 - 41067149
Alignment:
| Q |
1 |
aaccatactcagcagcaacataaagtgctgtttctccaccttgattctgc |
50 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
41067100 |
aaccatactcagcagcaacataaagagctgtttctccatcttggttctgc |
41067149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University