View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18575_low_50 (Length: 244)

Name: NF18575_low_50
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18575_low_50
NF18575_low_50
[»] chr1 (1 HSPs)
chr1 (77-228)||(1353458-1353609)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 77 - 228
Target Start/End: Complemental strand, 1353609 - 1353458
Alignment:
77 ggaaacaagttatatcgaataaatggtaatgagcggtttgaccaaatccggttcaacgttgtagccaacggttcttccactaaattcaaaccggggtttc 176  Q
    |||||||||||||| |||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||| |||||||    
1353609 ggaaacaagttataccgaataaatggtaatgagtggtttgaccaaacccgattcaacgttgtagccaacggttcttcctctaaattcaaaccagggtttc 1353510  T
177 tacatatttaaatctcaattttggtctagatgtgattcttttattgcattgt 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
1353509 tacatatttaaatctcaattttggtctagatgtgattcttttattgcattgt 1353458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University