View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18575_low_50 (Length: 244)
Name: NF18575_low_50
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18575_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 77 - 228
Target Start/End: Complemental strand, 1353609 - 1353458
Alignment:
| Q |
77 |
ggaaacaagttatatcgaataaatggtaatgagcggtttgaccaaatccggttcaacgttgtagccaacggttcttccactaaattcaaaccggggtttc |
176 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
1353609 |
ggaaacaagttataccgaataaatggtaatgagtggtttgaccaaacccgattcaacgttgtagccaacggttcttcctctaaattcaaaccagggtttc |
1353510 |
T |
|
| Q |
177 |
tacatatttaaatctcaattttggtctagatgtgattcttttattgcattgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1353509 |
tacatatttaaatctcaattttggtctagatgtgattcttttattgcattgt |
1353458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University