View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18575_low_54 (Length: 240)
Name: NF18575_low_54
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18575_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 7023659 - 7023885
Alignment:
| Q |
1 |
aattagcaataaaaatttaaagagagataatatgaaatatgaatctattttttcactaaatttaattaggaaaattaaacgagaatttatagttttgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023659 |
aattagcaataaaaatttaaagagagataatatgaaatatgaatctattttttcactaaatttaattaggaaaattaaacgagaatttatagttttgtat |
7023758 |
T |
 |
| Q |
101 |
atctaatttggtctataa---nnnnnnnnnctgttaataaaaatctacattataatctagactatagttttatatcatttatgttcattttctatgtttc |
197 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023759 |
atctaatttggtctataaatttttttttttctgttaataaaaatctacattataatctagactatagttttatatcatttatgttcattttctatgtttc |
7023858 |
T |
 |
| Q |
198 |
atctactcacaccacaaaggtacaaca |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7023859 |
atctactcacaccacaaaggtacaaca |
7023885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University