View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18575_low_58 (Length: 234)

Name: NF18575_low_58
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18575_low_58
NF18575_low_58
[»] chr7 (1 HSPs)
chr7 (21-223)||(43060066-43060272)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 223
Target Start/End: Original strand, 43060066 - 43060272
Alignment:
21 ttttattgcagaggtgtttttgttgagcaggctggaagtaatgtggcattatttttgcatcttttacaagttttaggatttttgtttaatttgttgcaaa 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43060066 ttttattgcagaggtgtttttgttgagcaggctggaagtaatgtggcattatttttgcatcttttacaagttttaggatttttgtttaatttgttgcaaa 43060165  T
121 tgcatccttattgtgaagtgtgctctttttgtttat----gatatttcttctgctgacaatgtgattaatttattggcgtttggcaagctcaaattcatg 216  Q
    ||||||||||||||| ||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||     
43060166 tgcatccttattgtgcagtgtgctctttttgtttatataagatatttcttctgctgacaatgtgattaatttattggcgtttggcaagctcaaattaatt 43060265  T
217 tgtgatg 223  Q
    |||||||    
43060266 tgtgatg 43060272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University