View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18575_low_62 (Length: 225)
Name: NF18575_low_62
Description: NF18575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18575_low_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 89 - 206
Target Start/End: Complemental strand, 1738591 - 1738474
Alignment:
| Q |
89 |
tgaggatatctaaatgattttacttttctattttggtaggggaatggacggctgaatggagcattcaaggtgcgtctatgcaagactaccaaagatatgg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1738591 |
tgaggatatctaaatgattttacttttctattttggtaggggaatggacggctgaatggagcatacaaggtgcgtctatgcaagactaccaaagatatgt |
1738492 |
T |
|
| Q |
189 |
ccaagcacaattggatgt |
206 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
1738491 |
ccaaacacaaatggatgt |
1738474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 89 - 206
Target Start/End: Complemental strand, 1717185 - 1717068
Alignment:
| Q |
89 |
tgaggatatctaaatgattttacttttctattttggtaggggaatggacggctgaatggagcattcaaggtgcgtctatgcaagactaccaaagatatgg |
188 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||| || ||||| || |||||||||||||||||||||||| |
|
|
| T |
1717185 |
tgaggatatctaaatgtttttacttttctatttgggtaggggaatggacagctgaatggagtatacaaggggcacctatgcaagactaccaaagatatgt |
1717086 |
T |
|
| Q |
189 |
ccaagcacaattggatgt |
206 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
1717085 |
ccaagcacaaatggatgt |
1717068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 1738673 - 1738616
Alignment:
| Q |
1 |
cacactacttatgcataataattaaactacagtaatagttaacattattgatagtttt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
1738673 |
cacactacttatgcataataattaaactacagtaatagtttactttattgatagtttt |
1738616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 1753672 - 1753628
Alignment:
| Q |
154 |
caaggtgcgtctatgcaagactaccaaagatatggccaagcacaa |
198 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1753672 |
caaggtgcatctatgcaagactaccaaagatatggccaagcacaa |
1753628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University