View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18576_high_15 (Length: 246)
Name: NF18576_high_15
Description: NF18576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18576_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 231
Target Start/End: Complemental strand, 13616933 - 13616720
Alignment:
| Q |
16 |
atgaagtatgtaggaaggaagtatcaactaacttactagaagaaaaattataagcatttttagatgagtaatcaccatctttttcgcccttcaaatttgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13616933 |
atgaagtatgtaggaaggaagtatcaactaacttactagaagaaaaattataagcatttttagatgagtaatcaccatccttttcgcccttcaaatttgc |
13616834 |
T |
 |
| Q |
116 |
ttaccctctattacaccataggagataacaatgtattgacaatattagccacattatcattatcatcaactacaaatgtaatcaatagaatgttctaagg |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13616833 |
ttaccctctatt--accataggagataacaatgtattgacaatattagccacattatcattatcatcaactacaaatgtaatcaatagaatgttctaagg |
13616736 |
T |
 |
| Q |
216 |
cttatcatgtggaatc |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
13616735 |
cttatcatgtggaatc |
13616720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University