View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18576_low_13 (Length: 277)
Name: NF18576_low_13
Description: NF18576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18576_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 46278040 - 46277815
Alignment:
| Q |
1 |
aattctcttacaaacatttctaacaattatctattaatatttgtcgtttnnnnnnnctagatcttcatacgagcttcaatcacggcatcaatattaaata |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46278040 |
aattcccttacaaacatttctaacaattagctattaatatttgtcgtttaaaaaaactagatcttcatacgagcttcaatcaccgcatcaatattaaata |
46277941 |
T |
|
| Q |
101 |
tttgtacacataggagtttatgattagttgaaagttacacaacatgcaagtaagatgataaatatacccaatactttattattttggattaaaatgtggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46277940 |
tttgtacacataggagtttatgattagttgaaagttacacaacatgcaagtaagatgataaatatatccaatactttattattttggattaaaatgtggt |
46277841 |
T |
|
| Q |
201 |
attcaatttcacttgtatgattcctt |
226 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46277840 |
gttcaatttcacttgtatgattcctt |
46277815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 270
Target Start/End: Complemental strand, 46277803 - 46277775
Alignment:
| Q |
242 |
caaatcacttgtaagtcgaatatgatgat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46277803 |
caaatcacttgtaagtcgaatatgatgat |
46277775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University