View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18576_low_13 (Length: 277)

Name: NF18576_low_13
Description: NF18576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18576_low_13
NF18576_low_13
[»] chr4 (2 HSPs)
chr4 (1-226)||(46277815-46278040)
chr4 (242-270)||(46277775-46277803)


Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 46278040 - 46277815
Alignment:
1 aattctcttacaaacatttctaacaattatctattaatatttgtcgtttnnnnnnnctagatcttcatacgagcttcaatcacggcatcaatattaaata 100  Q
    ||||| ||||||||||||||||||||||| |||||||||||||||||||       ||||||||||||||||||||||||||| ||||||||||||||||    
46278040 aattcccttacaaacatttctaacaattagctattaatatttgtcgtttaaaaaaactagatcttcatacgagcttcaatcaccgcatcaatattaaata 46277941  T
101 tttgtacacataggagtttatgattagttgaaagttacacaacatgcaagtaagatgataaatatacccaatactttattattttggattaaaatgtggt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
46277940 tttgtacacataggagtttatgattagttgaaagttacacaacatgcaagtaagatgataaatatatccaatactttattattttggattaaaatgtggt 46277841  T
201 attcaatttcacttgtatgattcctt 226  Q
     |||||||||||||||||||||||||    
46277840 gttcaatttcacttgtatgattcctt 46277815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 270
Target Start/End: Complemental strand, 46277803 - 46277775
Alignment:
242 caaatcacttgtaagtcgaatatgatgat 270  Q
    |||||||||||||||||||||||||||||    
46277803 caaatcacttgtaagtcgaatatgatgat 46277775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University