View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18576_low_19 (Length: 238)
Name: NF18576_low_19
Description: NF18576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18576_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 221
Target Start/End: Original strand, 36574595 - 36574806
Alignment:
| Q |
10 |
agagatgaaaactaggaaaaattgtgttttagaagaggaacatacttggatggctgcttgaagcaatttggaggaatatgatggatctgtatctctgaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574595 |
agagatgaaaactaggaaaaattgtgttttagaagaggaacatacttggatggctgcttgaagcaatttggaggaatatgatggatctgtatctctgaat |
36574694 |
T |
 |
| Q |
110 |
actaatgaagacgctgccaatgcagcagccgtctcagccgcgacatcagaacctggattttgagccgagaccttatacacattgcgtggagtgtccatgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574695 |
actaatgaagacgctgccaatgcagcagccgtctcagccgcgacatcagaacctggattttgagccgagaccttatacacattgcgtggagtgtccatgt |
36574794 |
T |
 |
| Q |
210 |
cctccggccttt |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36574795 |
cctccggccttt |
36574806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University