View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18576_low_9 (Length: 289)
Name: NF18576_low_9
Description: NF18576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18576_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 175719 - 175974
Alignment:
| Q |
18 |
atgaagctcaactttcctctaaatccttctaacattcgtgctatcatagctgactcttgcgatggcatcatctgtcttcaa-ccatcgatgacagattcg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
175719 |
atgaagctcaactttcctctaaatccttctaacattcgtgctatcatagctgactcttgcgatggcatcatctgtcttcaaaccatcgatgacagattcg |
175818 |
T |
 |
| Q |
117 |
actgtggtgatccgctactatggaacccttgtaccaccaaattcaatatattgccctctttggatttcgagaaaagtctacaaattgcatacaccattgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175819 |
actgtggtgatccgctactatggaacccttgtaccaccaaattcaatatattgccctctttggatttcgagaaaagtctacaaattgcatacaccattgg |
175918 |
T |
 |
| Q |
217 |
gtatgacgctcaatttacccatacttacaaggtagttgctgtttctagctatatat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175919 |
gtatgacgctcaatttacccatacttacaaggtagttgctgtttctagctatatat |
175974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University