View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18577_high_15 (Length: 263)
Name: NF18577_high_15
Description: NF18577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18577_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 4 - 135
Target Start/End: Complemental strand, 36904127 - 36903995
Alignment:
| Q |
4 |
ttgaggag-gagcagagagaacaccggcaaatcctcattgtggaatttgctccagagaagagagaacacttagacaattgctgcaggggtaattcaccat |
102 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36904127 |
ttgaggagagagaagagagaacaccggcaaatcctcattgtggaatttgctccagagaagagagaacacttagacaattgctgcaggggtaattcaccat |
36904028 |
T |
 |
| Q |
103 |
gttactagattaattggcaactaatatcatatg |
135 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
36904027 |
gttactagattaattgccaactaatatcatatg |
36903995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 95 - 132
Target Start/End: Original strand, 32491429 - 32491466
Alignment:
| Q |
95 |
ttcaccatgttactagattaattggcaactaatatcat |
132 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
32491429 |
ttcaccatgttattagattaattgacaactaatatcat |
32491466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University