View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18577_high_22 (Length: 236)
Name: NF18577_high_22
Description: NF18577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18577_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42991068 - 42990848
Alignment:
| Q |
1 |
atcaatttcatcgtgagttggcccttgtgacgacaactgcaccataagcaaaatgctagtaaaaacttttgatttcatgaaga-gctatgtatgttaatt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||| |||||| |||| | |||||||||| |||||||||||||||| |
|
|
| T |
42991068 |
atcaatttcgtcgtgagttggcccttgtgatgacaactgcaccataaggaaaatgctcgtaaaagctttcaacttcatgaagaagctatgtatgttaatt |
42990969 |
T |
|
| Q |
100 |
aaagttgctttcgaaaaagaaacaacgaaggaatataatatataatgtgaagaagacaagaaaagaatcaaattgtatgagtttgatttgaatgaattta |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42990968 |
aaagttgcttttgaaaaagaaacaacgaaggaatataatatataatgtgaagaaggcaagaaaagaatcaaattgtatgagtttgatttgaatgaa-tta |
42990870 |
T |
|
| Q |
200 |
gatggaaaaaagtactacgtac |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42990869 |
gatggaaaaaagtactacgtac |
42990848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University