View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18577_low_15 (Length: 289)
Name: NF18577_low_15
Description: NF18577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18577_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 14 - 287
Target Start/End: Complemental strand, 54472932 - 54472659
Alignment:
| Q |
14 |
atatatcggtagagtagaagcaagaaattccataagcagagaacacatatgtttggtaacaaagttataccaattgtgcagttcctttctatcatcgtca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472932 |
atatatcggtagagtagaagcaagaaattccataagcagagaacacatatgtttggtaacaaagttataccaattgtgcagttcctttctatcatcgtca |
54472833 |
T |
|
| Q |
114 |
tcttaaaagattaggatttaaattgtacaacttgtatttatatattacggttcaggcttcaaacccgcgcccctaatcaccccacgcaacttaccttcgt |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
54472832 |
tcttaaaagaataggatttaaattgtacaacttgtatttatatattacggttcaggcttcaaacccgcgtccctaatcacccctcgcaacttaccttcgt |
54472733 |
T |
|
| Q |
214 |
gtaactgtgttggttcaaaaaggcatgtcactctcgcttcgcttaattgactctcccacttattagcattataa |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472732 |
gtaactgtgttggttcaaaaaggcatgtcactctcgcttcgcttaattgactctcccacttattagcattataa |
54472659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University