View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18577_low_16 (Length: 286)
Name: NF18577_low_16
Description: NF18577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18577_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 109 - 273
Target Start/End: Original strand, 43360841 - 43361005
Alignment:
| Q |
109 |
tatcttattctaactgttactgtttaacatgcaattctataaagctgctactattgtcattggaggaaaacttgcagtactctaacatgtcatgtccttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43360841 |
tatcttattctaactgttactgtttaacatgcaattctataaagctgctactattgtcattggaggaaaacttgcagtactctaacatgtcatgtccttt |
43360940 |
T |
 |
| Q |
209 |
cgaaggtgatgttgtannnnnnnaatagtgttaattgttgtgtattgatattcaagctgtgattt |
273 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43360941 |
cgaaggtgatgttgtatttttttaatagtgttatttgttgtgtattgatattcaagctgtgattt |
43361005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 43360757 - 43360844
Alignment:
| Q |
1 |
tgtttgcactgtcatgtttcctcttcaaacaatttcgtgaaaaataaaaactgtaaatgtcaagctcacttgaacttggccaaatatc |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43360757 |
tgtttgcactgtcatgtttcctcttcaaacaatttcgtgaaaaataaaagctgtaaatgtcaagctcacttgaacttggccaaatatc |
43360844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 54 - 110
Target Start/End: Complemental strand, 49414407 - 49414351
Alignment:
| Q |
54 |
taaatgtcaagctcacttgaacttggccaaatatcaattgttagcctttagcaagta |
110 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
49414407 |
taaatatcaagctcacttgaacttagccaaatatcaatctttagcctttagcaagta |
49414351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 49414301 - 49414226
Alignment:
| Q |
151 |
agctgctactattgtcattggaggaaaacttgcagtactctaacatgtc--atgtcctttcgaaggtgatgttgta |
224 |
Q |
| |
|
|||| ||||||||||||||||| |||| ||| ||||| |||||||||| ||||||||| | |||||||||||| |
|
|
| T |
49414301 |
agctactactattgtcattggaagaaagtttgtagtaccctaacatgtcatatgtcctttaggtggtgatgttgta |
49414226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University