View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18577_low_20 (Length: 263)
Name: NF18577_low_20
Description: NF18577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18577_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 21745358 - 21745562
Alignment:
| Q |
18 |
cattcaaacatacctttaatttttaagtacttttttcctaaatgtatcatttaattattagtatctaaatcactcccaaactaatatagctttatattga |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21745358 |
cattcaaacatacccttaatttttaagtacttttttcctaaatgtatcatttaattattagtatctaaatcactcccaaactaatatagctttatattga |
21745457 |
T |
 |
| Q |
118 |
tgaaattgcccctttttaatgtgtaaaatcaataaatatgtaaatcatcgatgaacattatatgaaaatgagatgatataaactcccagagtttagtcta |
217 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21745458 |
tgaaattatccttttttaatgtgtaaaatcaataaatatgtaaatcatcgtcgaacattatatgaaaatgagatgatataaactcccagagtttagtcta |
21745557 |
T |
 |
| Q |
218 |
gtagt |
222 |
Q |
| |
|
||||| |
|
|
| T |
21745558 |
gtagt |
21745562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University