View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18577_low_24 (Length: 247)
Name: NF18577_low_24
Description: NF18577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18577_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 94 - 235
Target Start/End: Complemental strand, 45771116 - 45770975
Alignment:
| Q |
94 |
agattttcttgaccatggggttggatttcaaatcgtagccctgcattttcaattccctcctcacgacctctggcatcctcagcagtttcatgcatgtact |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45771116 |
agattttcttgaccatggggttggatttcaaatcgtagccctgcattttcaattccctcctcacgacctctggcatcctcagcagtttcatgcatgtact |
45771017 |
T |
 |
| Q |
194 |
catcctcattagtagcagcaaatcccccatcaaaatcttgat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45771016 |
catcctcattagtagcagcaaatcccccatcaaaatcttgat |
45770975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 45771215 - 45771160
Alignment:
| Q |
1 |
aaatcattatgttcttcatcatcttcatccacatcttcaccgtcaactccagacat |
56 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45771215 |
aaatcattatgttcttcgtcatcttcatccacatcttcaccgtcaactccagacat |
45771160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University