View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18577_low_28 (Length: 237)
Name: NF18577_low_28
Description: NF18577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18577_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 8437400 - 8437181
Alignment:
| Q |
1 |
gtatcaatgcaaataattaagaggaaattaaaataagctagtgaataatccaagagctgaccatgaaaaaccatatttgtttaata----ttacttgtcg |
96 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
8437400 |
gtatcaatgcaaa----taagaggaaattaaaagaagctagtgactaatccaagagctgaccatgaaaaaccatatttgtttaatattacttacttttcg |
8437305 |
T |
 |
| Q |
97 |
tcataatcttatggtatggcatttgacaaacctctctggtgaacccattacaatatagctagctgtaaggttaagagcttcaccttcctttaaatgggga |
196 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437304 |
t-ataatcttatggtatggcatttgacaaacctccctggtgaacccattacaatatagctagctgtaaggttaagagcttcaccttcctttaaatgggga |
8437206 |
T |
 |
| Q |
197 |
tcaagttaggaatccaagacgtata |
221 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
8437205 |
tcaaattaggaatccaagacgtata |
8437181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University