View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18577_low_31 (Length: 236)
Name: NF18577_low_31
Description: NF18577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18577_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 42339283 - 42339062
Alignment:
| Q |
1 |
atcataataaactttataaggggactaaatatcttcattcccaaatttctgtcattaaaacattaaactacaagcaaaagcttaaatggtaagcactatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42339283 |
atcataataaactttataaggggactaaatatcttcattcccaaatttctgtcattaaaacattaaactacaagcaaaagcttaaatggtaagtactatg |
42339184 |
T |
 |
| Q |
101 |
agtagtatgagttgagcagtcacattgcaaccaatcaggggtgaactgtattggccatccaagggacataagcatcttggatacaagggattaaagttgt |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42339183 |
agtaatatgagttgagcagtcacattgcaaccaatcaggggtgaactgtattgcccatccaagggacataagcatcttggatacaagggattaaagttgc |
42339084 |
T |
 |
| Q |
201 |
aaattgtattgcccatccaatt |
222 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
42339083 |
aaactgtattgcccatccaatt |
42339062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University