View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18577_low_5 (Length: 357)
Name: NF18577_low_5
Description: NF18577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18577_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 63 - 346
Target Start/End: Original strand, 48763700 - 48763983
Alignment:
| Q |
63 |
agaagttgagcagccagagcatacttcttcttccaaaaccaaacctcattccgatgaacaacctcatcacaaaattttgaaacaggtcaaccaacttgcc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763700 |
agaagttgagcagccagagcatacttcttcttccaaaaccaaacctcattccgatgaacaacctcatcacaaaattttgaaacaggtcaaccaacttgcc |
48763799 |
T |
 |
| Q |
163 |
taatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatctattcgtgttgatcatatctctctaaattgcatctctaca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763800 |
taatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatctattcgtgttgatcatatctctctaaattgcatctctaca |
48763899 |
T |
 |
| Q |
263 |
acttgactagggttttggttgggattttttaggtggagtattatttcagtgatttaaacttgtctaccaccgatcatttgatga |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
48763900 |
acttgactagggttttggttgggattttttaggtggagtattatttcagcgatttaaacttggctaccaccgatcatttgatga |
48763983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University