View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18578_low_5 (Length: 304)
Name: NF18578_low_5
Description: NF18578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18578_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 32 - 253
Target Start/End: Original strand, 4359321 - 4359552
Alignment:
| Q |
32 |
agagagatattgaaacacaaagaaagggatgaattgaggaggaagggtaatgggtctatatatatat--------gggaaag--gggagaaagaaaaacg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4359321 |
agagagatattgaaacacaaagaaagggttgaattgaggaggaagggtaatgggtctatatatatatatatatatgggaaagaggggagaaagaaaaacg |
4359420 |
T |
|
| Q |
122 |
tggttttattatttagtgcttgggtgggtgggtttgtgttgccttaagagttaagaggttgtagttgaatctcacgtgagattgtgtagtctaaatgaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4359421 |
tggttttattatttagtgcttgggtgggtgggtttgtgttgccttaagagttaagaggttgtagttgaatctcacgtgagattgtgtagtttaaatgaaa |
4359520 |
T |
|
| Q |
222 |
atgtcacgtgactttaaaaaatcatggacgta |
253 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
4359521 |
atgtcacgtgactataaaaaatcatggacgta |
4359552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 31 - 96
Target Start/End: Complemental strand, 4352931 - 4352866
Alignment:
| Q |
31 |
gagagagatattgaaacacaaagaaagggatgaattgaggaggaagggtaatgggtctatatatat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
4352931 |
gagagagatattgaaacacaaagaaagggatgaattgaagaggaagggaaatgggtgtatatatat |
4352866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 54 - 98
Target Start/End: Complemental strand, 4349507 - 4349463
Alignment:
| Q |
54 |
aaagggatgaattgaggaggaagggtaatgggtctatatatatat |
98 |
Q |
| |
|
||||||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
4349507 |
aaagggatgaattgaagaggaagggtgatgggtatatatatatat |
4349463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University