View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18579_high_16 (Length: 271)
Name: NF18579_high_16
Description: NF18579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18579_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 17 - 134
Target Start/End: Complemental strand, 46613053 - 46612936
Alignment:
| Q |
17 |
agtatttactagtgcttaatgacgccttcttcactaagtgtaataaaattgaatgcttggggaccaacttgcatgtttggatattgtcgatgtaaatcta |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46613053 |
agtatttactagtgcttgatgacgccttcttcactaagtgtaataaaattgaatgcttggggaccaacttgcatgtttggatattgtcgatgtaaatcta |
46612954 |
T |
|
| Q |
117 |
gagatgaagcacgaagac |
134 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46612953 |
gagatgaagcacgaagac |
46612936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 46612938 - 46612867
Alignment:
| Q |
181 |
gacagtgcccttgcttccacactgctaccaccttcccatgttgtcaaattaatagatcgttaagccgtaata |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46612938 |
gacagtgcccttgcttccacactgctaccaccttcccatgttgtcaaattaatagatcgttaagccgtaata |
46612867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University