View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18579_high_16 (Length: 271)

Name: NF18579_high_16
Description: NF18579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18579_high_16
NF18579_high_16
[»] chr1 (2 HSPs)
chr1 (17-134)||(46612936-46613053)
chr1 (181-252)||(46612867-46612938)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 17 - 134
Target Start/End: Complemental strand, 46613053 - 46612936
Alignment:
17 agtatttactagtgcttaatgacgccttcttcactaagtgtaataaaattgaatgcttggggaccaacttgcatgtttggatattgtcgatgtaaatcta 116  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46613053 agtatttactagtgcttgatgacgccttcttcactaagtgtaataaaattgaatgcttggggaccaacttgcatgtttggatattgtcgatgtaaatcta 46612954  T
117 gagatgaagcacgaagac 134  Q
    ||||||||||||||||||    
46612953 gagatgaagcacgaagac 46612936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 46612938 - 46612867
Alignment:
181 gacagtgcccttgcttccacactgctaccaccttcccatgttgtcaaattaatagatcgttaagccgtaata 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46612938 gacagtgcccttgcttccacactgctaccaccttcccatgttgtcaaattaatagatcgttaagccgtaata 46612867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University