View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18579_high_17 (Length: 260)
Name: NF18579_high_17
Description: NF18579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18579_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 45553681 - 45553916
Alignment:
| Q |
11 |
cataggtctcatttatatgttacactgcaaaccaaaaatgtcaaacagatgataaacatttgactacaagtggcccatatgaggctacaacatcataccc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45553681 |
cataggtctcatttatatgttacactgcaaaccaaaaatgtcaaacagatgataaacatttgactacaagtggcccatatgaggctacaacatcataccc |
45553780 |
T |
 |
| Q |
111 |
ctggttaccttgaccatgtaccgtacggaccgaaaaattggaccgtgcaggcaccacagcaaatttcggacgatgtttaagtaaaaatgttagttgatgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45553781 |
ctggttaccttgaccatgtaccgtacggaccgaaaaattggaccgtgcaggcagcgcagcaaatttcagacgatgtttaagtaaaaatgttagttgatgt |
45553880 |
T |
 |
| Q |
211 |
acaggataaataggtcacagcggaagtgcaaaaagt |
246 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45553881 |
acaggataaataggtcacagcagaagtgcaaaaagt |
45553916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University