View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18579_low_14 (Length: 330)
Name: NF18579_low_14
Description: NF18579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18579_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 13 - 308
Target Start/End: Complemental strand, 44751730 - 44751435
Alignment:
| Q |
13 |
agcaaaggggtacatcgcgctatgatacctaccgacagccaaatagagaacgtctcagctggagttgaactcattgaatcttcttcaagctaccaaatgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44751730 |
agcaaaggggtacatcgcgctatgatacctaccgacagccaaatagagaacgtctcagctggagttgaactcattgaatcttcttcaagctaccaaatgc |
44751631 |
T |
 |
| Q |
113 |
tgactcaaatggacgtgcttcggttcttgaaagatcacggcaatgaactacaaagcactctgcattcacattctgttcaagatttgggagcaatcaccga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
44751630 |
tgactcaaatggacgtgcttcggttcttgaaagatcacggcaatgaactacaaagcactctgcattcacattccgttcaagatttgggagcgatcaccga |
44751531 |
T |
 |
| Q |
213 |
aaggatttacgccatcaccgaacgcacaaaactcatcgatgccatcaagtgcttgaaagctgctatgttaaatgcacttccaattgttagagcctc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44751530 |
aaggatttacgccatcaccgaacgcacaaaactcatcgatgccatcaagtgcttgaaagctgctatgttaaatgcacttccaattgttagagcctc |
44751435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University